View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19128_low_49 (Length: 274)
Name: NF19128_low_49
Description: NF19128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19128_low_49 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 53; Significance: 2e-21; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 133 - 193
Target Start/End: Complemental strand, 38446947 - 38446887
Alignment:
| Q |
133 |
tgtgagaaactcaaatttataagtattgagtaaactgattttcctaagtactaggggagta |
193 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38446947 |
tgtgagaaaatcaaatttataagtattgagtaaactgattttcctaagtaccaggggagta |
38446887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 38447006 - 38446950
Alignment:
| Q |
48 |
gatgatgaagacatgatgatgctaatactaggtattgagtaaactgattttcaacccttc |
107 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38447006 |
gatgatgaagacatgatgatg---atactaggtattgagtaaactgattttcaacccttc |
38446950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 219 - 265
Target Start/End: Complemental strand, 38446888 - 38446842
Alignment:
| Q |
219 |
tacaaaattatctaatagtcatcaaactaacgattaactgtctgtga |
265 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38446888 |
tacaaaattatctcatagtcatcaaactaacgattaactgtctgtga |
38446842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 19 - 61
Target Start/End: Original strand, 53352101 - 53352143
Alignment:
| Q |
19 |
ttccttttttcaaccctttattagtgtccgatgatgaagacat |
61 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
53352101 |
ttccttttttcaaccctttgttagtatccgatgatgaagacat |
53352143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University