View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19128_low_55 (Length: 251)
Name: NF19128_low_55
Description: NF19128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19128_low_55 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 142 - 238
Target Start/End: Complemental strand, 24949269 - 24949170
Alignment:
| Q |
142 |
aacttacgtattat---acgtatattatttctttatccccataaaaaatagtagttccatatcacatttgaattctaataatattaattgactcttcttc |
238 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24949269 |
aacttacgtattattctacgtatattatttctttatccccataaaaaatagtagttccatatcacatttgaattctaataatattaattgactcttcttc |
24949170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 24949412 - 24949345
Alignment:
| Q |
1 |
actgatctgatcagtggatcatcggtcagatcacatgattattgacctagacattgatgagaaattct |
68 |
Q |
| |
|
|||||||| |||||||||||||||||| |||| ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
24949412 |
actgatctaatcagtggatcatcggtcggatcccatgactattgaccgagacattgatgagaaattct |
24949345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University