View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19128_low_55 (Length: 251)

Name: NF19128_low_55
Description: NF19128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19128_low_55
NF19128_low_55
[»] chr7 (2 HSPs)
chr7 (142-238)||(24949170-24949269)
chr7 (1-68)||(24949345-24949412)


Alignment Details
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 142 - 238
Target Start/End: Complemental strand, 24949269 - 24949170
Alignment:
142 aacttacgtattat---acgtatattatttctttatccccataaaaaatagtagttccatatcacatttgaattctaataatattaattgactcttcttc 238  Q
    ||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24949269 aacttacgtattattctacgtatattatttctttatccccataaaaaatagtagttccatatcacatttgaattctaataatattaattgactcttcttc 24949170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 24949412 - 24949345
Alignment:
1 actgatctgatcagtggatcatcggtcagatcacatgattattgacctagacattgatgagaaattct 68  Q
    |||||||| |||||||||||||||||| |||| ||||| |||||||| ||||||||||||||||||||    
24949412 actgatctaatcagtggatcatcggtcggatcccatgactattgaccgagacattgatgagaaattct 24949345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University