View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19129_low_7 (Length: 339)
Name: NF19129_low_7
Description: NF19129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19129_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 68 - 317
Target Start/End: Complemental strand, 15630021 - 15629772
Alignment:
| Q |
68 |
ttcaaaatgtaaagaatcatcatacctcgagatacatgtccattgcatggtaaagctcatcacaagaatccctagcagaatctggaagagctgtagcaag |
167 |
Q |
| |
|
||||||||| |||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15630021 |
ttcaaaatggaaagaatcattatacctcaagatacatgtccattgcatggtaaagctcatcacaagaatccctagcagaatctggaagagctgttgcaag |
15629922 |
T |
 |
| Q |
168 |
agccaaaaacttcgaagtttttaaacaaggatcaggtgcaatttcagctatatacaaatctattaagctagcaactttcctcatccgaacgggagcaacg |
267 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15629921 |
agccaaaaactttgaagtttttaaacaaggatcaggtgcaatttcagctatatacaaatctattaagctagcaactttcctcatccgaacgggagcaacg |
15629822 |
T |
 |
| Q |
268 |
gcaccagttccttgccgcaggaacgctttcaaaaatctcagaacaaggtt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15629821 |
gcaccagttccttgccgcaggaacgctttcaaaaatctcagaacaaggtt |
15629772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University