View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1912_high_8 (Length: 362)
Name: NF1912_high_8
Description: NF1912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1912_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 349
Target Start/End: Complemental strand, 44856325 - 44855992
Alignment:
| Q |
1 |
tgcacctggtttttatgtctatggtagtgctgttaaatgtaaggttctttgcagatacttgaccaataacctcagcaacaacaaacaagaaaaaggttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44856325 |
tgcacctggtttttatgtctatggtagtgctgttaaatgtaaggttctttgcaggtacttgaccaataacctcagcaacaacaaacaagacaaaggttta |
44856226 |
T |
|
| Q |
101 |
aacccatcaccttaaataaacccannnnnnnnnnnnnnnnnaatgtggaattggaaagtgtactctatttggtttggaatttagaatttggatcaggttc |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44856225 |
aacccatcaccttaaataaacccattttattttttatttttaatgtggaattggaaagtgtactctatttggtttggaatttagaatttggatcaggttc |
44856126 |
T |
|
| Q |
201 |
tattgttgttatgattcatggcttggttttttgttgttaaaaagtagtaacttcggtagatattttatagtatgtatttttcatgcttgagttgggatat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44856125 |
tattgttgttatgattcatggcttggttttttgttgtt--------------------gatattttatagtatgtatttttcatgcttgagttgggatat |
44856046 |
T |
|
| Q |
301 |
gata-----nnnnnnngggtcaacgtgaacaatttggcattttatggttaccct |
349 |
Q |
| |
|
|||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
44856045 |
gatatgtcggtatatggagtcaacgtgaacaatttggcattttatggttaccct |
44855992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University