View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19130_low_10 (Length: 260)
Name: NF19130_low_10
Description: NF19130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19130_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 247
Target Start/End: Complemental strand, 31691023 - 31690793
Alignment:
| Q |
17 |
atatacattgagatgcactcctttattactactttttgtgttctttttagttgtatcacattgcctaagtacgcaattcaggtgctaataaattgttggc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31691023 |
atatacattgagatgcactcctttattactactttttgtattctttttagttgtatcacattgcctaagtacgcaattcaggtgctaataaattgttggc |
31690924 |
T |
 |
| Q |
117 |
aatgttggttgaatttggannnnnnnnacaatcacacagaaattgcttattacaagtgcaaccaataaaatatttttgtatacagtctaagtcatgttca |
216 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31690923 |
aatgttggttgaatttggaggggggggacaatcacacagaaattgcttattacaagtgcaaccaataaaatattgttgtatacagtctaagtcatgttca |
31690824 |
T |
 |
| Q |
217 |
cataagggatcaatgtgtctgcttgttgcct |
247 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |
|
|
| T |
31690823 |
cataagcgatcaatgtgtctgcttgttgcct |
31690793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 17 - 112
Target Start/End: Original strand, 17760932 - 17761027
Alignment:
| Q |
17 |
atatacattgagatgcactcctttattactactttttgtgttctttttagttgtatcacattgcctaagtacgcaattcaggtgctaataaattgt |
112 |
Q |
| |
|
|||||||||| ||| || |||||||||| || ||||||| || |||||||||||||||||||| ||||||||| || ||||||| |||||||||| |
|
|
| T |
17760932 |
atatacattgggatacaatcctttattattaatttttgtattatttttagttgtatcacattgtctaagtacgtaactcaggtggaaataaattgt |
17761027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University