View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19130_low_9 (Length: 270)
Name: NF19130_low_9
Description: NF19130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19130_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 94 - 252
Target Start/End: Complemental strand, 35443146 - 35442988
Alignment:
| Q |
94 |
tgtatatttgtatagattgcatttcttctcgtggttttatgcagttggaaattttgtatagaatgaggttttattttttgattagtaaatagtagatagg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35443146 |
tgtatatttgtatagattgcatttcttctcgtggttttatgcagttggaaattttgtatagaatgaggttttattttttgattagtaaatagtagatagg |
35443047 |
T |
 |
| Q |
194 |
gtttgtttggttacaaaatgctaaaaatacatatatttatgtaaaataagtggttaaat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35443046 |
gtttgtttggttacaaaatgctaaaaatacatatatttatttaaaataagtggttaaat |
35442988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 16 - 96
Target Start/End: Complemental strand, 35443286 - 35443205
Alignment:
| Q |
16 |
tcactcattgttgatttagaatagaattttgcgaaaataaacaaaggaatcacctttgttctttacctt-ttttatgtttgt |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35443286 |
tcactcattgttgatttagaatagaattttgcgaaaataaacaaaggaatcacctttgttctttacctttttttatgtttgt |
35443205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 218 - 247
Target Start/End: Original strand, 16780329 - 16780358
Alignment:
| Q |
218 |
aaatacatatatttatgtaaaataagtggt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16780329 |
aaatacatatatttatgtaaaataagtggt |
16780358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University