View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19133_high_19 (Length: 319)
Name: NF19133_high_19
Description: NF19133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19133_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 8e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 130 - 304
Target Start/End: Complemental strand, 39732469 - 39732295
Alignment:
| Q |
130 |
atcagtcagaccgtctgatttgtgttgtttaataattaccaattgtgaaccaataaaaggtactgaagactgatctttcatccaccatattccagtataa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39732469 |
atcagtcagaccgtctgatttgtgttgtttaataattaccaattgtgaaccaataaaaggtactgaagactgatctttcatccaccatattccagtataa |
39732370 |
T |
 |
| Q |
230 |
ttgcgcaatatggacattttaaatttttcctgattgcatataccagtaatgtttccatttttatatgcaagtatt |
304 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39732369 |
ttgcgcaatatggacattttaaaattttcctgattgcatataccagtaatgtttccatttttatatgcaagtatt |
39732295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 13 - 131
Target Start/End: Complemental strand, 39732622 - 39732498
Alignment:
| Q |
13 |
aatatcgggatgagttttatcgtgatatttagcatttttc-----atagtaaaataggaa-gggtgtaacaagtttttataagacataaagcttcaccga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39732622 |
aatatcgggatgagttttatcgtgatatttagcatttttcttttcatagtaaaataggaaagggtgtgacaagtttttataagacataaagcttcaccga |
39732523 |
T |
 |
| Q |
107 |
cttggaagtgcattgaattgtatat |
131 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39732522 |
cttggaagtgcattgaattgtatat |
39732498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University