View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19133_high_21 (Length: 297)
Name: NF19133_high_21
Description: NF19133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19133_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 18 - 293
Target Start/End: Complemental strand, 53128433 - 53128158
Alignment:
| Q |
18 |
tcatctccaaatgcgggccacggtttgtaattcaggtggatttctttggtcgacggttaatacaatcacgcacacaaacagaaggaggaggatcgtcacc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
53128433 |
tcatctccaaatgcgggccacggtttgtaattccggtggatttctttggtcgacggttaatacaatcacgcgcacaaacagaaggaggaggatcgtcacc |
53128334 |
T |
 |
| Q |
118 |
ttggggcgtcgcggcgctggtggtgttgcttttggttttggcttccaaaatctccagcttcaggtctatgtggtcgccactcatttggagaccccattag |
217 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53128333 |
ttggggcgttgcggcgctggtggtgttgcttttggttttggcttccaaaatctccagcttcaggtctatgtggtcgccactcatttggagaccccattag |
53128234 |
T |
 |
| Q |
218 |
ttgatgtatcgtatcatttgtaagtcataacatctatgaaatagaaatttgtcacctatcttacgcatctgtgctc |
293 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53128233 |
ttgatgtatcatatcatttgtaagtcataacatctatgaaatagaaatttgtcacctatcttacgcatctgggctc |
53128158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University