View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19133_high_28 (Length: 250)
Name: NF19133_high_28
Description: NF19133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19133_high_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 52972643 - 52972415
Alignment:
| Q |
18 |
aatatgtcttcctgtttctagatgatgtttaaatcttcccataaaggagcgatacgcaggtatgaccaaggcagatattgaaactcttaactctgattga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52972643 |
aatatgtcttcctgtttctagatgatgtttaaatcttcccataaaggagcgatacgcaggtatgaccaaggcagatattgaaactcttaactctgattga |
52972544 |
T |
 |
| Q |
118 |
agttgttcatcgctcaccatccaactactttgcgtcttgtggatatcttcaaacatggaattgaaacacttaaacctctctctcaaaacctgcttagaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
52972543 |
agttgttcatcgctcaccatccaactactttgcgtcttgtggatatcttcaaacatggaattgaaacacttaaacctctctctcaaaacctgcttagaga |
52972444 |
T |
 |
| Q |
218 |
ccttgttcccttgttgatgatgtccatct |
246 |
Q |
| |
|
|||||||||||||||||||| | |||||| |
|
|
| T |
52972443 |
ccttgttcccttgttgatgaaggccatct |
52972415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University