View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19133_high_39 (Length: 222)
Name: NF19133_high_39
Description: NF19133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19133_high_39 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 211
Target Start/End: Original strand, 40960932 - 40961126
Alignment:
| Q |
17 |
atattattcgcgcaggacttgctgaccgatatatggtttgcaccttaatgctttactgatatttaattaaaatttaaaaactcatctaatgcacttttaa |
116 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40960932 |
atattattcgtgcaggacttgctgaccgatatatggtttgcaccttaatgctttactgatatttaattaaaatttaaaaactcatctaatgcacttttaa |
40961031 |
T |
|
| Q |
117 |
tgacccgggttttgattgttgctctgcttgttcagctggaatgtatcgcctgtggtcattcttggtctgcttcttgtgatgcggtgtctgtgctg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40961032 |
tgacccgggttttgattgttgctctgcttgttcagctggaatgtatcgcctgtggtcattcttggtctgcctcttgtgatgcggtgtctgtgctg |
40961126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 135 - 210
Target Start/End: Original strand, 40947856 - 40947931
Alignment:
| Q |
135 |
ttgctctgcttgttcagctggaatgtatcgcctgtggtcattcttggtctgcttcttgtgatgcggtgtctgtgct |
210 |
Q |
| |
|
||||||||||||||||||||||||| || || ||||||||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
40947856 |
ttgctctgcttgttcagctggaatgcatagcttgtggtcattcctggtctgcctctcgtgatgcggtgtctgtgct |
40947931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 80
Target Start/End: Original strand, 40947744 - 40947807
Alignment:
| Q |
17 |
atattattcgcgcaggacttgctgaccgatatatggtttgcaccttaatgctttactgatattt |
80 |
Q |
| |
|
||||||| || |||||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
40947744 |
atattatccgtgcaggatatgctgaccgatatatggtcagcgccttaatgctttactgatattt |
40947807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University