View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19133_high_42 (Length: 212)
Name: NF19133_high_42
Description: NF19133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19133_high_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 19 - 201
Target Start/End: Original strand, 14926891 - 14927073
Alignment:
| Q |
19 |
ataacaggagaagaagttcttatatgatattgttgcaaacggtcgcaatggaattgacgttgacaagtaagttgatacttttcaccttttttcctcctga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14926891 |
ataacaggagaagaagttcttatatgatattgttgcaaacggtcgcaatggaattgacgttgacaagtaagttgatacttttcaccttttttcctcctga |
14926990 |
T |
 |
| Q |
119 |
tgtgccactattattgataccgaatcttgtgatcatagaaccataacaaattcaagaatttgcagatttgactatattcttcg |
201 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
14926991 |
tgtgccactgttattgataccgaatctcgtgatcatagaaccataacaaattcaagaatttgcagatttgactacattgttcg |
14927073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 35 - 90
Target Start/End: Original strand, 1528297 - 1528352
Alignment:
| Q |
35 |
ttcttatatgatattgttgcaaacggtcgcaatggaattgacgttgacaagtaagt |
90 |
Q |
| |
|
||||| ||||||||||||||||| || || |||||||| || |||||||||||||| |
|
|
| T |
1528297 |
ttcttgtatgatattgttgcaaatggacgaaatggaatcgatgttgacaagtaagt |
1528352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University