View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19133_low_27 (Length: 250)
Name: NF19133_low_27
Description: NF19133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19133_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 10 - 235
Target Start/End: Original strand, 47128085 - 47128309
Alignment:
| Q |
10 |
gcagagattaggaagttgggtattgaaacacaactatgggatgaatctcgcaaagaattggaacaagaaactaacaattccaaagcgctgagtcgctctg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47128085 |
gcagagattaggaagttgggtattgaaacacaactatgggatgaatctcgcaaagaattggaacaagaaactaacaattccaaagcgctgagtcgttctg |
47128184 |
T |
|
| Q |
110 |
acttttgatgatgatagacaactaaaataggnnnnnnnnnnnnnnnnnnnnatcctttcacatacaattctaaggtgaagttgtctatcacaaagtcttg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47128185 |
acttttgatgatgatagacaactaaaatagg-ttttttctttcaattttttatcctttcacatacaattctaaggtgaagttgtctatcacaaagtcttg |
47128283 |
T |
|
| Q |
210 |
gatgaataggttacatcttttaagtg |
235 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
47128284 |
gatgaataggttacatcttttaagtg |
47128309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University