View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19133_low_31 (Length: 249)
Name: NF19133_low_31
Description: NF19133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19133_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 126 - 241
Target Start/End: Complemental strand, 4663720 - 4663605
Alignment:
| Q |
126 |
gtgcttctctctttcttatgttaaccctgcttcatagaatcaccataggtttctcggcagacagtacacacacaaatctttgattctgatttagggtttc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4663720 |
gtgcttctctctttcttatgttaaccctgcttcatagaatcaccataggtttctcggcagacagtacacacacaaatctttgattctgatttagggtttc |
4663621 |
T |
 |
| Q |
226 |
attttcttcttcttct |
241 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
4663620 |
attttcttcttcttct |
4663605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 4663845 - 4663764
Alignment:
| Q |
1 |
tgaatattttgattattttcagccaacttaaatgtgggccttgttcgggttaaaccggcccaagtttctggtttgttttttc |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4663845 |
tgaatattttgattattttcagccaacttaaatgtgggccttgttcgggttaaaccggcccaagtttctggtttgttttttc |
4663764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University