View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19133_low_35 (Length: 237)
Name: NF19133_low_35
Description: NF19133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19133_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 11 - 224
Target Start/End: Original strand, 4663919 - 4664132
Alignment:
| Q |
11 |
ttcatccgattgttagggtaagagatcttgataatgcggactcaatcgtaagtaaagtaaagtttgataaataattagttaattattttttaaatcagat |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| || |
|
|
| T |
4663919 |
ttcatccgattgttagggtaagagatcttgataatgcggactcaatcgtaagtaaagtaaagtttgataaataattagttaatca-tttttaaatcaaat |
4664017 |
T |
 |
| Q |
111 |
tttctcaaacaatttgtctataattggaaatcatttaccttttaaccaaccac---aatttctttttgttacaaggcgaaagaacaaggaaaaaagaaat |
207 |
Q |
| |
|
|||||| || |||||||||||||||| |||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4664018 |
tttctcgaataatttgtctataattgaaaatcatttaccttttaaccaaccacttgattttctttttgttacaaggcgaaagaacaaggaaaaa--aaat |
4664115 |
T |
 |
| Q |
208 |
caacagaatgttacaag |
224 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
4664116 |
caacagaatgttacaag |
4664132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University