View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19133_low_42 (Length: 219)
Name: NF19133_low_42
Description: NF19133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19133_low_42 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 39415834 - 39416017
Alignment:
| Q |
18 |
atactgttaataataataacattacaactgtctctgcccaaccatttcaatagtgctaaagtaaaagtacaatcctccgtatctcttttcttgttttgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39415834 |
atactgttaataataataacattacaactgtccctgcccaaccatttcaatagtgctaaagtaaaagtacaatcctccgtatctcttttcttgttttgga |
39415933 |
T |
|
| Q |
118 |
aaacaccatgctgaatgaaaaccttctaaaacccatctattaatggcttagcattattattaccacagtgaatacagctgcaac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39415934 |
aaacaccatgctgaatgaaaaccttctaaaacccatctattaatggcttagcattattattaccacagtgaatacagctgcaac |
39416017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University