View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19134_low_2 (Length: 408)
Name: NF19134_low_2
Description: NF19134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19134_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 4e-94; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 217 - 391
Target Start/End: Original strand, 5035401 - 5035575
Alignment:
| Q |
217 |
gtttcaagtttcaacctaagggtgaagaaagctttcacacacccctctgatttgaagaatttggtgttcagcataatcagaaattgtggaagatggcttt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5035401 |
gtttcaagtttcaacctaagggtgaagaaagctttcacacacccctctgatttgaagaatttggtgttcagcataatcagaaattgtggaagatggcttt |
5035500 |
T |
 |
| Q |
317 |
aatctcaagtacgaggagtgaagacattctatcaaattttgaatgaattgttttatgtaatttaataacttttat |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5035501 |
aatctcaagtacgaggagtgaagacattctatcaaattttgaatgaattgttttatgtaatttaataacttttat |
5035575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 14 - 158
Target Start/End: Original strand, 5035200 - 5035344
Alignment:
| Q |
14 |
atatctacactcagcataaacccaaaaattaatgtctttggaatggaagcgacataataatgcaataaagcaatatatgatcaatatataaatttttgtt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5035200 |
atatctacactcagcataaacccaaaaattaatgtctttggaatggaagcaacataataatgcaataaagcaatatatgatcaatatataaatttttgtt |
5035299 |
T |
 |
| Q |
114 |
tcatgtataaaaaatatgcttaattttcttgagtttttgttgaat |
158 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5035300 |
tcatgtataaaaaatatgcttaattttgttgagtttttgttgaat |
5035344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University