View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19134_low_4 (Length: 293)
Name: NF19134_low_4
Description: NF19134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19134_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 15 - 275
Target Start/End: Complemental strand, 1798234 - 1797974
Alignment:
| Q |
15 |
aaaatccaaaacaaaccagcttgaaatagcatttgcagatcaacgagcaacgacccatcacagaaacacaacagtggttcttacacaaaccaaagaccag |
114 |
Q |
| |
|
|||||||||| | |||| |||||||||||||||||||||||||||||||||||||||| || ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1798234 |
aaaatccaaagccaacccgcttgaaatagcatttgcagatcaacgagcaacgacccattacggaaacacaacaatggttcttacacaaaccaaagaccag |
1798135 |
T |
|
| Q |
115 |
aatcacgaccacccaaacgaaacccacaaaccaccgtcggtgccggacccaaaaacaactttttccacaaccaccggtgccggaaatgcggcatatctag |
214 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| ||| || | |||||||||||||||| ||||||||||||||||| |||| |||||||| |||| | |
|
|
| T |
1798134 |
agtcacgaccacccaaacgaaacccacaaaccaccatcgatgtcagacccaaaaacaacttcttccacaaccaccggtgtcggagatgcggcagatctgg |
1798035 |
T |
|
| Q |
215 |
aagaagggtggtacgaaaacaacaaagcaccgtcggcgccgagacccgaaaacagcttctt |
275 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1798034 |
aagaagggtggtacgaaaacaacacagcaccgtcggcgccgagacccgaaaacagcttctt |
1797974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University