View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19135_low_5 (Length: 265)
Name: NF19135_low_5
Description: NF19135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19135_low_5 |
 |  |
|
| [»] scaffold0053 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0053 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: scaffold0053
Description:
Target: scaffold0053; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 42 - 249
Target Start/End: Original strand, 75475 - 75684
Alignment:
| Q |
42 |
ttgtgtgataaggtaaatttaaatcccttcgtaaggactatttttattttctt--ggttacaccttcgtaaggactatgtcactatccacttactttaaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
75475 |
ttgtgtgataaggtaaatttaaatcccttcgtaaggactatttttatttttttttggttaccccttcgtaaggactatgtcactatccacttactttaaa |
75574 |
T |
 |
| Q |
140 |
gttttattaggnnnnnnnnggtgtaggatgaagagaataaaagtataagatacactcgctcaatcaaattaactagattgttaattcaaaagaccaatcg |
239 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
75575 |
tttttattaggaaaaaaaaggtgtaggatgaagagaataaaagtataagatacactcgctcaatcaaattaactagattgttaattcaaaagaccaatcg |
75674 |
T |
 |
| Q |
240 |
ctaacaaaac |
249 |
Q |
| |
|
|||||||||| |
|
|
| T |
75675 |
ctaacaaaac |
75684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University