View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19135_low_9 (Length: 227)
Name: NF19135_low_9
Description: NF19135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19135_low_9 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 35909286 - 35909060
Alignment:
| Q |
1 |
ccacataattgggacctttgctaggatgcacatagtattttaaatcttgattttgtgaaggatcagtgataacattgctctaagcatgactggtggaaac |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35909286 |
ccacatatttgggacctttgctaggatgcacatagtattctaaatcttgattttgtgaaggatcagtgataacattgctctaagcatgactggtggaaac |
35909187 |
T |
|
| Q |
101 |
attgatgttgcatgccatgaaaactcgaaatgaagctcaagaatctataaaatctaagaaaacgatgagtcaacaagaaattgttgtgaataaaaagcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35909186 |
attgatgttgcatgccatgaaaactcgatatgaagctcaagaatctataaaatctaagaaaacgatgaatcaacaagaaattgttgtgaataaaaagcaa |
35909087 |
T |
|
| Q |
201 |
ttatgaaaaattgcaacgaagatgtaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
35909086 |
ttatgaaaaattgcaacgaagatgtaa |
35909060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University