View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19136_low_11 (Length: 209)
Name: NF19136_low_11
Description: NF19136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19136_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 19 - 194
Target Start/End: Original strand, 46813283 - 46813455
Alignment:
| Q |
19 |
tctcattttgctttcatttgatta-ataagttgaattcaataaaataaataatagtaattgataatggttttgttgcagggtacaacgctgtctgaattg |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46813283 |
tctcattttgctttcatttgattatataagttgaattcaataaaat----aatagtaattgataatggttttgttgcagggtacaacgctgtctgaattg |
46813378 |
T |
 |
| Q |
118 |
tctgggaaaaggctatgactagaactagattgtaaaattcatatcttatgtgatgattattttagtgcttgagaact |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46813379 |
tctgggaaaaggctatgactagaactagattgtaaaattcatatcttatgtgatgattattttagtgcttgagaact |
46813455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University