View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19139_high_29 (Length: 205)

Name: NF19139_high_29
Description: NF19139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19139_high_29
NF19139_high_29
[»] chr1 (3 HSPs)
chr1 (33-94)||(38790063-38790124)
chr1 (144-194)||(38790382-38790432)
chr1 (109-142)||(38790155-38790188)


Alignment Details
Target: chr1 (Bit Score: 54; Significance: 3e-22; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 33 - 94
Target Start/End: Original strand, 38790063 - 38790124
Alignment:
33 agtatggatagtgattatcaattgaggatatgtgcaatattgaataaaagattgatcatatt 94  Q
    |||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||    
38790063 agtatggatagtgatattcaattgaggatatgtgcaatattgaataaaagattgatcatatt 38790124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 144 - 194
Target Start/End: Original strand, 38790382 - 38790432
Alignment:
144 ttatttttatcttttggaaaagaggattgaattggataagaattatctacc 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||    
38790382 ttatttttatcttttggaaaagaggattgaattggataagaattatatacc 38790432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 109 - 142
Target Start/End: Original strand, 38790155 - 38790188
Alignment:
109 attatttacccaaaaatgaaagtttttgtatagt 142  Q
    ||||||||||||||||||||||||||||||||||    
38790155 attatttacccaaaaatgaaagtttttgtatagt 38790188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University