View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19139_low_19 (Length: 301)
Name: NF19139_low_19
Description: NF19139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19139_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 11 - 289
Target Start/End: Original strand, 36463560 - 36463838
Alignment:
| Q |
11 |
catcatcaccgccaaccctctgaacgttgaatacattctcaaaaccaatttcactaacttccctaaaggaaaacccttcactgaaattctaagtgacctt |
110 |
Q |
| |
|
|||||| |||||||| ||||| || ||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
36463560 |
catcataaccgccaatcctctcaatgttgaatacatcctcaaaaccaatttcaccaacttccctaaaggtaaacccttcacagaaattctcagtgacctt |
36463659 |
T |
|
| Q |
111 |
ttaggttgcggcatattcaatgcggatggaaagttgtggtcaaagcagcgtaaaataggcagccacgaattcacaacaaggtctctcaaagactttgttg |
210 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||| || ||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36463660 |
ttaggttgcggcatattcaatgtagatggaaagttatggtcaaaacaacgtaaaataggtagccatgaattcacaacaaggtctctcaaagactttgttg |
36463759 |
T |
|
| Q |
211 |
caaagacacttgaagatgaagttcaacaaagacttattccattgcttgaattggcttctgatggaaaccatgttattga |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36463760 |
caaagacacttgaagatgaagttcaacaaagacttattccattgcttgaattggcttctgatggaaaccatgttattga |
36463838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University