View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19139_low_32 (Length: 205)
Name: NF19139_low_32
Description: NF19139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19139_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 54; Significance: 3e-22; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 33 - 94
Target Start/End: Original strand, 38790063 - 38790124
Alignment:
| Q |
33 |
agtatggatagtgattatcaattgaggatatgtgcaatattgaataaaagattgatcatatt |
94 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38790063 |
agtatggatagtgatattcaattgaggatatgtgcaatattgaataaaagattgatcatatt |
38790124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 144 - 194
Target Start/End: Original strand, 38790382 - 38790432
Alignment:
| Q |
144 |
ttatttttatcttttggaaaagaggattgaattggataagaattatctacc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38790382 |
ttatttttatcttttggaaaagaggattgaattggataagaattatatacc |
38790432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 109 - 142
Target Start/End: Original strand, 38790155 - 38790188
Alignment:
| Q |
109 |
attatttacccaaaaatgaaagtttttgtatagt |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38790155 |
attatttacccaaaaatgaaagtttttgtatagt |
38790188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University