View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1913_high_35 (Length: 331)
Name: NF1913_high_35
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1913_high_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 268; Significance: 1e-149; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 323
Target Start/End: Original strand, 25922615 - 25922931
Alignment:
| Q |
1 |
tagagaaggattggagctatagacggtgttggagtaaccgtaacggtgatggcacccaagtcaatcgcaaaacgaagacagaaagcatgtgtggcgacgg |
100 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||| |
|
|
| T |
25922615 |
tagagaaggattggagctatagatgttgttggagttaccgtaacggtgatggcacccaagtcaatctcaaaacgaagacagaaagcatgtttggcggcgg |
25922714 |
T |
 |
| Q |
101 |
cggcgatgacgggaggcgccgacaggttgagtggtttaccggattctatattgtgccacatcctttcatttctcccaacgagaacctctgtggccacaat |
200 |
Q |
| |
|
|| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25922715 |
cg------acgggaggcaccgacaggttgagtggtttaccggattctatattgtgccacatcctttcatttctcccaacgagaacctctgtggccacaat |
25922808 |
T |
 |
| Q |
201 |
gaatcttgtctctcgcaggtggcgcaatctctggaaacatgttcaggtcttcgacttcgacttcgattgtgacggtgtaagtgcagattatgaaaggttt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25922809 |
gaatcttgtctctcgcaggtggcgcaatctctggaaacatgctcaggtcttcgacttcgacttcgattgtgacggtgtaagtgcagattatgaaaggttt |
25922908 |
T |
 |
| Q |
301 |
aggtttttcgttaactctgtgct |
323 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
25922909 |
aggtttttcgttaactctgtgct |
25922931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 234
Target Start/End: Complemental strand, 25032359 - 25032291
Alignment:
| Q |
166 |
tcatttctcccaacgagaacctctgtggccacaatgaatcttgtctctcgcaggtggcgcaatctctgg |
234 |
Q |
| |
|
||||| |||||||| |||||||| ||||| |||| || ||| |||||||||||||||| ||||||||| |
|
|
| T |
25032359 |
tcattcctcccaaccagaacctccgtggcaacaacgagtctcatctctcgcaggtggcgaaatctctgg |
25032291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 166 - 256
Target Start/End: Original strand, 45339362 - 45339452
Alignment:
| Q |
166 |
tcatttctcccaacgagaacctctgtggccacaatgaatcttgtctctcgcaggtggcgcaatctctggaaacatgttcaggtcttcgact |
256 |
Q |
| |
|
||||||||||||| | |||||| |||||| | |||| ||||||||| | |||||| ||||||| ||||| ||| ||||||||||||||| |
|
|
| T |
45339362 |
tcatttctcccaatgtgaacctatgtggcaatgatgagtcttgtctcccataggtggtgcaatctttggaatcatcttcaggtcttcgact |
45339452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University