View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1913_high_38 (Length: 324)
Name: NF1913_high_38
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1913_high_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 20 - 309
Target Start/End: Original strand, 1824012 - 1824301
Alignment:
| Q |
20 |
gttaaatcatccaaatataatgtctatattaacattgaagaaatgttaatttaacaatatgcagcagcaaaacagtagatatctgaaacaagaaatccat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1824012 |
gttaaatcatccaaatataatgtctatattaacattgaagaaattttaatttaacaatatgcagcagcaaaacagtagatatctgaaacaagaaatccat |
1824111 |
T |
 |
| Q |
120 |
aagtttcaatgaatatgatatagtgtgaaagcaatcattcacattaagttttttcggtttgattagcaaatatatagcatagtttttgcattaggatgaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1824112 |
aagtttcaatgaatatgatatagtgtgaaagcaatcattcacattaacttttttcggtttgattagcaaatatatagcatagtttttgcattaggatgaa |
1824211 |
T |
 |
| Q |
220 |
aaatccataagtttcaatgaaacaatgatatatcaaacactctctcttacatttcctttatgttatctgttggattttttgtcatctgtg |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1824212 |
aaatccataagtttcaatgaaacaatgatatatcaaacactctctcttacatttcctttatgttatctgttggattttttgtcatctgtg |
1824301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University