View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1913_high_46 (Length: 284)
Name: NF1913_high_46
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1913_high_46 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 8851036 - 8851302
Alignment:
| Q |
1 |
tttgaatgttaagttttgaacgacatgtatggcgacttctacgatgtataatgtagaaatttgtcacctatctggaattttttctggaaatttgaattat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8851036 |
tttgaatgttaagttttgaacgacatgtatggcgacttctacgatgtataatgtagaaatttgtcatctatctggaattttttctggaaatttgaattat |
8851135 |
T |
|
| Q |
101 |
tgtaggttttctttactaatttatcgtacagttcggaagcacttgactaccatagactacaaaactaacttatccaacctagaacttgcattgaattata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8851136 |
tgtaggttttctttactaatttatcgtacagttcggaagcacttgactaccatagactacaaaactaacttatccaacctagaacttgcattgaattata |
8851235 |
T |
|
| Q |
201 |
catgtataagttttagtattgactcgttgattagtcaagatgctcatagatttgggatggttgctct |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8851236 |
catgtataagttttagtattgactcgttgattagtcaagatgctcatagatttgggatggttgctct |
8851302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University