View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1913_high_49 (Length: 269)
Name: NF1913_high_49
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1913_high_49 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 64; Significance: 5e-28; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 188 - 251
Target Start/End: Original strand, 1361868 - 1361931
Alignment:
| Q |
188 |
ataaaatgtcaactacatttcttaatttatgtaaaattgttaaagcaattataattgccaaaat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1361868 |
ataaaatgtcaactacatttcttaatttatgtaaaattgttaaagcaattataattgccaaaat |
1361931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 4 - 49
Target Start/End: Original strand, 1361680 - 1361725
Alignment:
| Q |
4 |
tagcaaaatatgtttgttccaaatgtcattttacaatttcaataag |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1361680 |
tagcaaaatatgtttgttccaaatgtcattttacaatttcaataag |
1361725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University