View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1913_high_56 (Length: 255)
Name: NF1913_high_56
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1913_high_56 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 8 - 255
Target Start/End: Complemental strand, 31301676 - 31301426
Alignment:
| Q |
8 |
cgaagaaaatatcaaaccggcaagacatctgaatcatgattcaacttccttaaattgctcaaatcgggactaatccgtgatcgaattggtaaaataacca |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31301676 |
cgaacaaaatatcaaaccggcaagacatctgaatcatgattcaacttccttaaattgctcaaatcgggactaatccgtgatcgaattggtaaaataacca |
31301577 |
T |
 |
| Q |
108 |
aacagtactatagaatggaccgttcggttcaagttttaaaacactgttctagtccataataaaaaat---atgcagtctagtttagtccccttgnnnnnn |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31301576 |
aacagtactatagaatggaccgttcggttcaagttttaaaacactgttctagtccataataaaaaataggatgcagtctagtttagtccccttgaaaaaa |
31301477 |
T |
 |
| Q |
205 |
nntctataaatagtttttcatcattacaaaatcgggagacggtagtcttgg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31301476 |
aatctataaatagtttttcatcattacaaaatcgggagacggtagtcttgg |
31301426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University