View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1913_high_70 (Length: 239)
Name: NF1913_high_70
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1913_high_70 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 45593998 - 45593778
Alignment:
| Q |
19 |
cagatgtctcattgcaggtgaaaaacaacggaacacaaagcctgaaagtgtcaacaccaaagcttgaagatgtcaacctgattcaggaacaaaatgccag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45593998 |
cagatgtctcattgcaggtgaaaaacaaccgaacacaaagcctgaaagtgtcaacaccaaagcttgaagatgtcaacctgattcaggaacaaaatgccag |
45593899 |
T |
 |
| Q |
119 |
tagctacaaactgaagattgaagatgatatatctggttcagattcaggaaattatgaatttcttgatacttctgattctgcactgaagcacctactgcgt |
218 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45593898 |
tagctacaaactgaagcttgaagatgatatatctggttcagattcaggaaattatgaatttcttgatacttctgattctgcactgaagcacctactgcgc |
45593799 |
T |
 |
| Q |
219 |
atgcccgatgaaataggtttc |
239 |
Q |
| |
|
||||| ||||||||||||||| |
|
|
| T |
45593798 |
atgcctgatgaaataggtttc |
45593778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University