View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1913_high_73 (Length: 237)
Name: NF1913_high_73
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1913_high_73 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 21 - 224
Target Start/End: Complemental strand, 1216906 - 1216703
Alignment:
| Q |
21 |
caggcccactttgacttcaagtactgcaaactgaagaacgtctcaaaagattcaggaaaacttatatacgaagttgggtaacctaatcttacagtggcgt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1216906 |
caggcccactttgacttcaagtactgcaaagtgaagaacgtctcaaaagattcaggaaaacttatatacgaagttgggtaacctaatcttacagtggcgt |
1216807 |
T |
|
| Q |
121 |
ggcgtaaacaaacataatagataacaattctaatgtaccttgcactttaatggtgtcaataaattttttgggtttaggaacaacacccccactttgaatc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1216806 |
ggcgtaaacaaacataatagataacaattctaatgtaccttgcactttaatggtgtcaataaattttttgggtttaggaacaacacccccactttgaatc |
1216707 |
T |
|
| Q |
221 |
tctg |
224 |
Q |
| |
|
|||| |
|
|
| T |
1216706 |
tctg |
1216703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University