View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1913_high_75 (Length: 236)
Name: NF1913_high_75
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1913_high_75 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 102 - 219
Target Start/End: Original strand, 37935999 - 37936117
Alignment:
| Q |
102 |
tcatttcatatttataagataatatatttaactataattttaccaaatgtaacat-----atccaatcagttaacttatcggatatcaactatccgctaa |
196 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| || |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37935999 |
tcatttcatatttataagataat----ttaactataattttaccaaatgtaatattatatatccaatcagtttacttatcggatatcaactatccgctaa |
37936094 |
T |
|
| Q |
197 |
ttcacctataaggctgattatat |
219 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37936095 |
ttcacctataaggctgattatat |
37936117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 9 - 91
Target Start/End: Original strand, 37935760 - 37935842
Alignment:
| Q |
9 |
tatatattatagacagttgtgaggcagtattgtgtaatttgaaaaaatttataatactttgtttcgtttatggatatattaaa |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
37935760 |
tatatattatagacagttgtgaggcagtattgtgtaatttgaaaaaatttataatattttgtttcatttatggatatattaaa |
37935842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University