View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1913_high_79 (Length: 231)
Name: NF1913_high_79
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1913_high_79 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 15 - 208
Target Start/End: Complemental strand, 44950850 - 44950669
Alignment:
| Q |
15 |
gttactataatgctttcctctctcacgtacattcattgattcagtgccagttgcacatcatcaccgcggatgcaatgttaatactagcggaaaagggctg |
114 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44950850 |
gttactataatgctttcctctctcac--------attgattcagtgccagttgcacatcatcaccgcggatgcaatgttaatactagcggaaaagggctg |
44950759 |
T |
|
| Q |
115 |
agactatttgggttcgacgtagaatgtgattcttcttctccagcatcaccacaagcgacaatatgcctaatcaatcattcaacaacttctgggg |
208 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44950758 |
agactatttgggttcgacatagaatgtgattcttcttctccagcatcaccacaagcgacaatatgccta----atcattcaacaacttctgggg |
44950669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 49 - 153
Target Start/End: Original strand, 48596707 - 48596811
Alignment:
| Q |
49 |
attgattcagtgccagttgcacatcatcaccgcggatgcaatgttaatactagcggaaaagggctgagactatttgggttcgacgtagaatgtgattctt |
148 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||| |||||||||||||| |||||||| || |||||||||||||| | || | ||||||||||||| |
|
|
| T |
48596707 |
attgattcagttccagttgcacatcatcacctcggaggcaatgttaatactggcggaaaacggttgagactatttggggttaacatggaatgtgattctt |
48596806 |
T |
|
| Q |
149 |
cttct |
153 |
Q |
| |
|
||||| |
|
|
| T |
48596807 |
cttct |
48596811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University