View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1913_high_81 (Length: 227)
Name: NF1913_high_81
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1913_high_81 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 45593442 - 45593539
Alignment:
| Q |
1 |
taatcaacagttgttgaagaacgtgaacaaaatcactagttgttaatccattgatctaaccattctctgtccacccttttccccctctaaacatggac |
98 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45593442 |
taatcaacagttgttgaaggacgtgaacaaaatcactagttgttaatccattgatctaaccattctctgtccacccttttccccctctaaacatggac |
45593539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 227
Target Start/End: Original strand, 45593540 - 45593644
Alignment:
| Q |
132 |
catgcatttttcaaaaatgaagatatcacaaaaaggttgagaaaac-----taactatt----ctaccatatatcagagtatttgcctttctctattgaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45593540 |
catgcatttttcaaaaatgaagatatcacaaaaaggttgagaaaactaaactaactattctacctaccatatatcagagtatttgcctttctctattgaa |
45593639 |
T |
 |
| Q |
223 |
gagac |
227 |
Q |
| |
|
||||| |
|
|
| T |
45593640 |
gagac |
45593644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University