View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1913_high_82 (Length: 227)
Name: NF1913_high_82
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1913_high_82 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 2382124 - 2382339
Alignment:
| Q |
1 |
gatgaaattctctcggcaggtggagttgtggcagaacatcatgcatcctgttcgtaggttttggatttccattgccacacgttttggaattcgtaaaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2382124 |
gatgaaattctctcggcaggtggagttgtggcagaacatcatgcatcctgttcgtaggttttggatttccattgccacacgttttggaattcgtaaaact |
2382223 |
T |
|
| Q |
101 |
ggtaataattcaaaacatgtttggtcctttttctgtatttttggttacatagtacatgtttggttttgatgtttgcaaattcttcaaacaatagcatgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2382224 |
ggtaataattcaaaacatgtttggtcctttttctgtatttttggttacatagtacatgtttggttttgatgtttgcaa-----------aatagcatgtg |
2382312 |
T |
|
| Q |
201 |
ctgagttttgcacgttaattgtaacat |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2382313 |
ctgagttttgcacgttaattgtaacat |
2382339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University