View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1913_low_35 (Length: 332)
Name: NF1913_low_35
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1913_low_35 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 273 - 332
Target Start/End: Original strand, 17751414 - 17751473
Alignment:
| Q |
273 |
tgcaatagtgatagcgttgccattgcggaggcatcagaatctctgacttgttccaatgat |
332 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17751414 |
tgcaatggtgatagcgttgccattgcggaggcatcagaatctctgacttgttccaatgat |
17751473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 273 - 332
Target Start/End: Original strand, 17760401 - 17760460
Alignment:
| Q |
273 |
tgcaatagtgatagcgttgccattgcggaggcatcagaatctctgacttgttccaatgat |
332 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17760401 |
tgcaatggtgatagcgttgccattgcggaggcatcagaatctctgacttgttccaatgat |
17760460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University