View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1913_low_44 (Length: 306)
Name: NF1913_low_44
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1913_low_44 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 17 - 306
Target Start/End: Original strand, 8447263 - 8447557
Alignment:
| Q |
17 |
aatgtcgtgatcttgatatgcaggtacttgaccaaatggctgaaaattaaacaagcaatgtgaaaa-ttatgatgatgactaacataacaacaaggtaga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |||||||||| |
|
|
| T |
8447263 |
aatgtcgtgatcttgatatgcaggtacttgaccaaatggctgaaaattaaacaagcaatgtcaaaaattatgatgatgactaaca-----acaaggtaga |
8447357 |
T |
 |
| Q |
116 |
agaagtgaagtgtatgaatta---------ttattattacatggattttgaggaaatcaggttttctgtgttcagctttggacatgttgagagagatgag |
206 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8447358 |
agaagtgaagtgtatgaattattattattattattattacatggattttgaggaaatcaggttttctgtgttcagctttggacatgttgagagagatgag |
8447457 |
T |
 |
| Q |
207 |
ttggaattggatttctttctcattgagacatgccaacactcttgagacggcggttgacaaggctggtccgtacactttcactggtgtcgccatttcttct |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8447458 |
ttggaattggatttctttctcattgagacatgccaacactcttgagacggcggttgacaaggctggtccgtacactttcactggtgtcgccatttcttct |
8447557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University