View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1913_low_48 (Length: 288)
Name: NF1913_low_48
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1913_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 29 - 275
Target Start/End: Complemental strand, 55232681 - 55232435
Alignment:
| Q |
29 |
gtagacattgatggaagacgaacctgaaaaatatcaaacccatttcagtgaatatatcaagcgtggaattgaagcggatggaatcgaggaactatacaaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55232681 |
gtagacattgatggaagacgaacctgaaaaatatcaaacccatttcagtgaatatatcaagcgtggaattgaagcggatggaatcgaggaactatacaaa |
55232582 |
T |
 |
| Q |
129 |
aaggttcatgctgcaattcgtgcagatccctcaatcaaaaagcctgagaagcagccaccaaaggaacacaagaggtattgcattaggatgtttctaacta |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55232581 |
aaggttcatgctgcaattcgtgcagatccctcaatcaaaaagcctgagaagcagccaccaaaggaacacaagaggtattgcattaggatgtttctaacta |
55232482 |
T |
 |
| Q |
229 |
tttgctattgatgattggcaagttgaatgaccctgtttgaattagta |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55232481 |
tttgctattgatgattggcaagttgaatgaccctgtttgaattagta |
55232435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 114 - 207
Target Start/End: Complemental strand, 10463902 - 10463809
Alignment:
| Q |
114 |
gaggaactatacaaaaaggttcatgctgcaattcgtgcagatccctcaatcaaaaagcctgagaagcagccaccaaaggaacacaagaggtatt |
207 |
Q |
| |
|
||||| || ||||| ||||||||||||||||||||||||||||| ||||||| || | ||||||||||| ||||| ||||||||||||||| |
|
|
| T |
10463902 |
gaggagctttacaagaaggttcatgctgcaattcgtgcagatcctacaatcaagaaatccgagaagcagcctccaaaacaacacaagaggtatt |
10463809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University