View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1913_low_62 (Length: 254)

Name: NF1913_low_62
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1913_low_62
NF1913_low_62
[»] scaffold0011 (1 HSPs)
scaffold0011 (7-254)||(240549-240796)


Alignment Details
Target: scaffold0011 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 7 - 254
Target Start/End: Complemental strand, 240796 - 240549
Alignment:
7 tcgaagaatatggggtgttggatgatttatttcacatgggatagctgacttgtgagacactttaccaatatagaatacgacttgcactttgctcatattg 106  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
240796 tcgaaaaatatggggtgttggatgatttatttcacatgggatagctgacttgtgagacactttaccaatatagaatacgacttgcactttgctcatattg 240697  T
107 caatcttccgagtctcagttttggtaaaattttagcaccttagttaaatagagacataaaatagaacaatacagcaaattccatgtgtgaagccgataag 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
240696 caatcttccgagtctcagttttggtaaaattttagcaccttagttaaatagagacataaaatagaacaatacagcaaattccatgtgtgaagccgataag 240597  T
207 agtgtaacacctaaatttgaaagcaaagtaaaatggatttaattttta 254  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||    
240596 agtgtaacacctaaatgtgaaagcaaagtaaaatggatttaattttta 240549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University