View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1913_low_69 (Length: 248)
Name: NF1913_low_69
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1913_low_69 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 5 - 248
Target Start/End: Original strand, 37935345 - 37935587
Alignment:
| Q |
5 |
tagattattcttttgggagggatgagaactatttgtacttcatcatatcatattgtatggatcttgtac--cacttatatttatcacatcttattcaata |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37935345 |
tagattattcttttgggagggatgagaactatttgtacttcatcatatcatattgtatggatcttgtaccacacttatatttatcacatcttattcaata |
37935444 |
T |
|
| Q |
103 |
aaacatgttatttgctattaaaaac-aaacccctcatctcaaaatt---ctacttactaagccccttacttatgtgcctcctattaggagaattcgttaa |
198 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37935445 |
aaacatgttatttgctattaaaaacaaaacccctcatctcaaaattctactacttactaagccccttacttatgtgcctcctattaggagaattcgttaa |
37935544 |
T |
|
| Q |
199 |
gggacttatgtgcggatgcatcatgtatgtagagtggaattggggttgtt |
248 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37935545 |
gggacttatgtgcggatgc-------atgtagagtggaattggggttgtt |
37935587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University