View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1913_low_71 (Length: 247)
Name: NF1913_low_71
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1913_low_71 |
 |  |
|
| [»] chr8 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 4 - 247
Target Start/End: Complemental strand, 40479596 - 40479349
Alignment:
| Q |
4 |
atgtcgaagaatattagacaactaggaagaaagtgaggagaagttgtgtcctcttgcagtcatttctgacgggtaattgagatggacgtgtactactacg |
103 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40479596 |
atgtcaaagaatattagacaactaggaagaaagtgaggagaagttgtgtcctcttgcagtcatttctgacgggtaattgagatggacgtgtactactacg |
40479497 |
T |
 |
| Q |
104 |
acgtaagaagagatacgatgaagatgatgcttgcttccattattattataca----aactggaacgttgaatatctaacatcactttcaaacatgttttg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40479496 |
acgtaagaagagatacgatgaagatgatgcttgcttgcattattattatacaaattaactggaacgttgaatatctaacatcactttcaaacatgttttg |
40479397 |
T |
 |
| Q |
200 |
aaattaaggtaaagatagtttattgaagaaggaaatagttaaaaacaa |
247 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40479396 |
aaattaaggtaaagataatttattgaagaaggaaatagttaaaaacaa |
40479349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 191
Target Start/End: Complemental strand, 40471513 - 40471475
Alignment:
| Q |
153 |
acaaactggaacgttgaatatctaacatcactttcaaac |
191 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
40471513 |
acaaactgcaacgttgaatatctatcatcactttcaaac |
40471475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 231
Target Start/End: Complemental strand, 40484104 - 40484021
Alignment:
| Q |
148 |
attatacaaactggaacgttgaatatctaacatcacttt-caaacatgttttgaaattaaggtaaagatagtttattgaagaagg |
231 |
Q |
| |
|
|||| ||||| || ||||||||||| || ||||||||| ||||| | |||||||||||||| ||| ||| |||||||||||||| |
|
|
| T |
40484104 |
attacacaaattgcaacgttgaataattatcatcacttttcaaactt-ttttgaaattaaggcaaacataatttattgaagaagg |
40484021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University