View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1913_low_79 (Length: 237)

Name: NF1913_low_79
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1913_low_79
NF1913_low_79
[»] chr6 (1 HSPs)
chr6 (21-224)||(1216703-1216906)


Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 21 - 224
Target Start/End: Complemental strand, 1216906 - 1216703
Alignment:
21 caggcccactttgacttcaagtactgcaaactgaagaacgtctcaaaagattcaggaaaacttatatacgaagttgggtaacctaatcttacagtggcgt 120  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1216906 caggcccactttgacttcaagtactgcaaagtgaagaacgtctcaaaagattcaggaaaacttatatacgaagttgggtaacctaatcttacagtggcgt 1216807  T
121 ggcgtaaacaaacataatagataacaattctaatgtaccttgcactttaatggtgtcaataaattttttgggtttaggaacaacacccccactttgaatc 220  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1216806 ggcgtaaacaaacataatagataacaattctaatgtaccttgcactttaatggtgtcaataaattttttgggtttaggaacaacacccccactttgaatc 1216707  T
221 tctg 224  Q
    ||||    
1216706 tctg 1216703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University