View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1913_low_82 (Length: 235)

Name: NF1913_low_82
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1913_low_82
NF1913_low_82
[»] chr8 (1 HSPs)
chr8 (12-218)||(29018848-29019054)


Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 12 - 218
Target Start/End: Original strand, 29018848 - 29019054
Alignment:
12 agcagagatatgtaattgacccatcgtgcgtggaatggaacaattcaatgtgttattattggtagcaaagttatgtgcattacaatttacaaacccgacc 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||     
29018848 agcagagatatgtaattgacccatcgtgcgtggaatggaacaattcaatgtgttattattggtagcaaaattatgtgcattacaatttacaaacccgaca 29018947  T
112 aaaaagtagaacatgtaaacaaggaagaataagatctatcgttggtaagatatgttttgcttctaagtgttattttattgaaataatgatagataagcac 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29018948 aaaaagtagaacatgtaaacaaggaagaataagatctatcgttggtaagatatgttttgcttctaagtgttattttattgaaataatgatagataagcac 29019047  T
212 ttggtgt 218  Q
    |||||||    
29019048 ttggtgt 29019054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University