View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1913_low_83 (Length: 235)
Name: NF1913_low_83
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1913_low_83 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 12 - 146
Target Start/End: Original strand, 50235180 - 50235314
Alignment:
| Q |
12 |
gagatgaaatcaggacttgtgaagccgattttttgccagattgtgatggagtatcgacactcgcgaacacagtgcaagaatgtttcgtctttctcttcac |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
50235180 |
gagaagaaatcaggacttgtgaagccgattttttgctagattgtgatggagtatcgacagtcgcgaacacagtgcaagaaggtttcatctttctcttcac |
50235279 |
T |
|
| Q |
112 |
atctcgagcaaatagcagaatttgcgatgtgtctg |
146 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| |
|
|
| T |
50235280 |
atatcgagcaaatagcagaatttgcgatgtgtctg |
50235314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 143 - 218
Target Start/End: Complemental strand, 50235720 - 50235645
Alignment:
| Q |
143 |
tctggtttagcaattggagttctcatggtttacttggttcccttgtccctatcattgacatccacgacctccacct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50235720 |
tctggtttagcaattggagttctcatggtttacttggttcccttgtccctatcattgacatccacgacctccacct |
50235645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 145 - 206
Target Start/End: Original strand, 39463172 - 39463233
Alignment:
| Q |
145 |
tggtttagcaattggagttctcatggtttacttggttcccttgtccctatcattgacatcca |
206 |
Q |
| |
|
||||| ||||||||||| |||||||| | ||||||||| | |||||||||||||||||||| |
|
|
| T |
39463172 |
tggttcagcaattggagctctcatggctaccttggttccttggtccctatcattgacatcca |
39463233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 145 - 215
Target Start/End: Complemental strand, 6640169 - 6640099
Alignment:
| Q |
145 |
tggtttagcaattggagttctcatggtttacttggttcccttgtccctatcattgacatccacgacctcca |
215 |
Q |
| |
|
||||| || |||||||| |||||||| | ||||||||| | ||||||||||||||||||||||| |||| |
|
|
| T |
6640169 |
tggttcagtaattggagctctcatggctaccttggttccttgatccctatcattgacatccacgacatcca |
6640099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 209
Target Start/End: Complemental strand, 42402369 - 42402305
Alignment:
| Q |
145 |
tggtttagcaattggagttctcatggtttacttggttcccttgtccctatcattgacatccacga |
209 |
Q |
| |
|
||||| || |||||||| |||||||| | |||||||| | ||||||||||||||||||||||| |
|
|
| T |
42402369 |
tggttcagtaattggagctctcatggctaccttggttcattggtccctatcattgacatccacga |
42402305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University