View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1913_low_92 (Length: 216)
Name: NF1913_low_92
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1913_low_92 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 22 - 200
Target Start/End: Complemental strand, 55931777 - 55931599
Alignment:
| Q |
22 |
taggtctttgtcccatcatcactaataagattcttattatggtaatcgattttctttgttcattatttcatcttttcatatgacttctttcctaatttga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55931777 |
taggtctttgtcccatcatcactaataagattcttattatggtaatcgattttctttgttcattatttcatcttttcatatgacttctttcctaatttga |
55931678 |
T |
 |
| Q |
122 |
agtgtttcaagaagcctttcaagttacagggtcatcaatattccaaatttgattgttctttatttggttcatctaatca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55931677 |
agtgtttcaagaagcctttcaagttacagggtcatcaatattccaaatttgattgttctttatttggttcatctaatca |
55931599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University