View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1913_low_93 (Length: 211)
Name: NF1913_low_93
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1913_low_93 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 20 - 175
Target Start/End: Original strand, 4536053 - 4536206
Alignment:
| Q |
20 |
cagtctatgccgagcacgggcccatgtttaacacgggtttgcgtcgttagttatttaataatcataaaaacaaatgacagtatatgagaatatttgtaaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4536053 |
cagtctatgccgagcacgggcccatgtttaacacgggtttg--tcgttagttatttaataatcataaaaacaaatgacagtatatgagaatatttgtaaa |
4536150 |
T |
|
| Q |
120 |
ataatagactttatttagttgtaaatttggaagacagcacaattttatttcacagg |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4536151 |
ataatagactttatttagttgtaaatttggaagacagcacaattttatttcacagg |
4536206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University