View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1913_low_94 (Length: 208)
Name: NF1913_low_94
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1913_low_94 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 30 - 172
Target Start/End: Complemental strand, 12646371 - 12646225
Alignment:
| Q |
30 |
tgatgcctgataaaacttcagattgttctggctcgtgttatgtttctagtcgttttgcaaatgatacatacacgtat----tttagggtagcgaattttt |
125 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
12646371 |
tgatgcctgacaaaacttcacattgttctggctcgtgttatgtttctagtcgttttgcaaattatacatacacgtatcttaattagggtagcgaattttt |
12646272 |
T |
 |
| Q |
126 |
tgtgacaattaaaaacaattcaaatttgatgttatttatgtgattgt |
172 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12646271 |
tgcgacaattaaaaacaattcaaatttgatgttatttatgtgattgt |
12646225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University