View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1913_low_95 (Length: 204)

Name: NF1913_low_95
Description: NF1913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1913_low_95
NF1913_low_95
[»] chr4 (3 HSPs)
chr4 (42-185)||(10001613-10001746)
chr4 (49-81)||(38909276-38909308)
chr4 (42-77)||(7295705-7295740)
[»] chr8 (2 HSPs)
chr8 (42-76)||(2402709-2402743)
chr8 (46-105)||(27935449-27935506)


Alignment Details
Target: chr4 (Bit Score: 71; Significance: 2e-32; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 42 - 185
Target Start/End: Original strand, 10001613 - 10001746
Alignment:
42 tattagtaatgtatcttacgattcataataagattcaaataccgcgattcagaaaatagttcttttgattcacgatacgaatctc-aatgctcatagtaa 140  Q
    ||||||||||| |||||||||||||||||||||||| | ||||           ||||||| ||| |||||| |||||||||||| |||||||||| |||    
10001613 tattagtaatgcatcttacgattcataataagattcgattacc-----------aatagttatttcgattcatgatacgaatctctaatgctcatattaa 10001701  T
141 ggaggggtaatgtagagcagtaaaatcactaaccttagtttcagg 185  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
10001702 ggaggggtaatgtagagcagtaaaatcactaaccttagtttcagg 10001746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 49 - 81
Target Start/End: Complemental strand, 38909308 - 38909276
Alignment:
49 aatgtatcttacgattcataataagattcaaat 81  Q
    |||||||||||||||||||||||||||||||||    
38909308 aatgtatcttacgattcataataagattcaaat 38909276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 42 - 77
Target Start/End: Original strand, 7295705 - 7295740
Alignment:
42 tattagtaatgtatcttacgattcataataagattc 77  Q
    ||||||||||||||||||| ||||||||||||||||    
7295705 tattagtaatgtatcttacaattcataataagattc 7295740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 76
Target Start/End: Original strand, 2402709 - 2402743
Alignment:
42 tattagtaatgtatcttacgattcataataagatt 76  Q
    ||||||||||||||||||||||||||| |||||||    
2402709 tattagtaatgtatcttacgattcatagtaagatt 2402743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 105
Target Start/End: Complemental strand, 27935506 - 27935449
Alignment:
46 agtaatgtatcttacgattcataataagattcaaataccgcgattcagaaaatagttctt 105  Q
    ||||||||||| || ||||||||||||||||||| |  | || |||||||||||||||||    
27935506 agtaatgtatcatatgattcataataagattcaatt--cacgtttcagaaaatagttctt 27935449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University