View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19140_low_5 (Length: 278)
Name: NF19140_low_5
Description: NF19140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19140_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 25 - 266
Target Start/End: Original strand, 38355956 - 38356198
Alignment:
| Q |
25 |
tgtctagtgtatgtgtctgtcgtatccgtgcttta----cagcacaagcctaaaacgacttgggttttttatccggcccacagtagttgggcttggctaa |
120 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38355956 |
tgtctagtgtatgtgtc---cgtatccgtgctttatttacagcacaagcctaaaacgacttgggttttttatccggcccacagtagttgggcttggctaa |
38356052 |
T |
|
| Q |
121 |
ataatatgtagactaatatcaaatgggccgagccgattttactcatttacgtagttcatttgatagctctaaaaattacctgtaatgagagacccatctt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38356053 |
ataatatgtagactaatatcaaatgggccgagccgattttactcatttacgtagttcatttgacagctctaaaaattacctgtaatgagagacccatctt |
38356152 |
T |
|
| Q |
221 |
tatcttggatgtatgttgcagttgcagacttccactcttcatctct |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38356153 |
tatcttggatgtatgttgcagttgcagacttccactcttcatctct |
38356198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University