View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19141_high_19 (Length: 286)
Name: NF19141_high_19
Description: NF19141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19141_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 24 - 276
Target Start/End: Original strand, 14782999 - 14783248
Alignment:
| Q |
24 |
agtattttgagagtaaacttgatgaggttgaaccaacaaagagtaagagaaagttgattatcaaaagtggcatgtaccttttgtttgtaatggatttttg |
123 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14782999 |
agtattttgagagtaaacttgatgagattgaaccaacaaagagtaagagatagttgattatcaaaagtggcatgtaccttttgtttgtaatggatttttg |
14783098 |
T |
 |
| Q |
124 |
atcatttgcatgcaggtggtttttgttgttgacaaatggtgatggttgattttgatgttgttgtgtttcttcttcttgatgatcaatggcttcaatgtca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14783099 |
atcatttgcatgcaggtggtttttgttgttgacaaatggtgatggttgattttgatgttgttgtgt---ttcttcttgatgatcaatggcttcaatgtca |
14783195 |
T |
 |
| Q |
224 |
attgtgtcttctttgttggtagggttcatggtgagagattgatgatgatgatg |
276 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14783196 |
attgtgtcttcattgttggtagggttcgtggtgagagattgatgatgatgatg |
14783248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University