View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19141_high_24 (Length: 249)
Name: NF19141_high_24
Description: NF19141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19141_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 111 - 232
Target Start/End: Complemental strand, 1617061 - 1616940
Alignment:
| Q |
111 |
gatatattaattttgtcgttaattgtcaatgaaggttcactctttgtatgttgaaggtcataaattcaactcttgatatcgatgtgaaaatctcactatt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||| |||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1617061 |
gatatattaattttgtcgttaattgtcaatgaagattgactcttcgtatgttgaaggtcgtgaattcaactcttgatatcgatgtgaaaatctcactatt |
1616962 |
T |
|
| Q |
211 |
cactaatatatgatcaggaagt |
232 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1616961 |
tactaatatatgatcaggaagt |
1616940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 1618741 - 1618651
Alignment:
| Q |
1 |
tagtcctcaaagataaaaactacttcctccatttttagaaacttgnnnnnnnngttagtatgtcgtataatttgaaatagatggtaattttta |
93 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||| ||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
1618741 |
tagtcctcaaaaataaaaactatttcctccatttttagaaactt--tttttttgttagtatgtcgtataatttggaatagatagtaattttta |
1618651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University